WormBase Tree Display for Variation: WBVar00091621
expand all nodes | collapse all nodes | view schema
WBVar00091621 | Evidence | Paper_evidence | WBPaper00038142 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok323 | |||||
Other_name | ZC21.2b.1:c.1147_2133del | ||||||
CE33009:p.Arg379_Ter707delextTer? | |||||||
ZC21.2a.1:c.1135_2121del | |||||||
CE54118:p.Arg383_Ter711delextTer? | |||||||
HGVSg | CHROMOSOME_III:g.8538101_8539466del | ||||||
Sequence_details | SMap | S_parent | Sequence | ZC21 | |||
Flanking_sequences | tgacaaagataatttcagatgccaaaaagc | tatgtgatgaattgtctattcaacactgtc | |||||
Mapping_target | ZC21 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK323_external | ||||||
OK323_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035547 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006614 | |||||
Transcript | ZC21.2a.1 (11) | ||||||
ZC21.2b.1 (11) | |||||||
Genetics | Mapping_data | In_multi_point | 4740 | ||||
Description | Phenotype_not_observed | WBPhenotype:0001273 | Paper_evidence | WBPaper00038142 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Using a thermal barrier assay to test heat avoidance, no defect in heat avoidance was observed. | Paper_evidence | WBPaper00038142 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038142 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |