WormBase Tree Display for Variation: WBVar00091624
expand all nodes | collapse all nodes | view schema
WBVar00091624 | Name | Public_name | ok326 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_IV:g.16308707_16311089del | |||||||
Sequence_details | SMap | S_parent | Sequence | K03D3 | ||||
Flanking_sequences | aattgggctttttccttataatctcgaatt | caaatgtgtcgtcgttggtgacggagccgt | ||||||
Mapping_target | K03D3 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK326_external | |||||||
OK326_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035523 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00044670 | ||||||
WBGene00004287 | ||||||||
Transcript | K03D3.10.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-3/3 | |||||||
Exon_number | 2-4/4 | |||||||
Pseudogene | K03D3.13 | VEP_consequence | non_coding_transcript_exon_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-11 | |||||||
Exon_number | 1/5 | |||||||
Interactor | WBInteraction000524754 | |||||||
Genetics | Mapping_data | In_multi_point | 4621 | |||||
Description | Phenotype | WBPhenotype:0000195 | Paper_evidence | WBPaper00046150 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Anterior distal tip cells (DTCs) overshoot the vulval region because of a defect in cessation of their migration. | Paper_evidence | WBPaper00046150 | |||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00046150 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00032446 | |||||||
WBPaper00035198 | ||||||||
WBPaper00046150 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |