WormBase Tree Display for Variation: WBVar00091701
expand all nodes | collapse all nodes | view schema
WBVar00091701 | Name | Public_name | ok406 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C34G6.7a.1:c.307-41_1328del | ||||||||
C34G6.7a.2:c.307-41_1328del | |||||||||
HGVSg | CHROMOSOME_I:g.5902308_5903684del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C34G6 | |||||
Flanking_sequences | tgtgaagacggagcaggccattgttgttgc | ggtgaaatgtatcgtattttcgtattatac | |||||||
Mapping_target | C34G6 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK406_external | ||||||||
OK406_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031413 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004109 | |||||||
Transcript | C34G6.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C34G6.7a.1:c.307-41_1328del | ||||||||
cDNA_position | ?-1384 | ||||||||
CDS_position | ?-1328 | ||||||||
Protein_position | ?-443 | ||||||||
Intron_number | 4-7/8 | ||||||||
Exon_number | 5-8/9 | ||||||||
C34G6.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 3-5/5 | ||||||||
Exon_number | 4-6/6 | ||||||||
C34G6.7a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C34G6.7a.2:c.307-41_1328del | ||||||||
cDNA_position | ?-1378 | ||||||||
CDS_position | ?-1328 | ||||||||
Protein_position | ?-443 | ||||||||
Intron_number | 4-7/8 | ||||||||
Exon_number | 5-8/9 | ||||||||
Interactor | WBInteraction000502402 | ||||||||
WBInteraction000502943 | |||||||||
WBInteraction000502944 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00040092 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals lacking STAM exhibit a high level of embryonic lethality; however, 10% are viable and grow to adulthood. | Paper_evidence | WBPaper00040092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00040092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000106 | Paper_evidence | WBPaper00027739 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant hermaphrodites exhibit an expanded pattern of MAPK activation in which MAPKYT staining extends to distal oocytes | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027739 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Antibody staining to the diphosphorylated activated form of MAPK (MAPK-YT) | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00040092 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In the absence of STAM, Hrs protein levels were reduced roughly 2-fold. | Paper_evidence | WBPaper00040092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00040092 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000274 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stam-1(ok406) hermaphrodites produce greater than 80% unfertilized and dead eggs. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000313 | Paper_evidence | WBPaper00027739 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Hermaphrodites exhibited an incompletely penetrant delay in nuclear envelope breakdown during oocyte meiotic maturation | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027739 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stam-1(ok406) hermaphrodites produce greater than 80% unfertilized and dead eggs. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | LOV-1::GFP and PKD-2::GFP localize normally to the cilium proper of CEM neurons; however, both LOV-1::GFP and PKD-2::GFP accumulate at the ciliary base and are often observed in discrete puncta in the ciliary base region. In RnB neurons of stam-1 mutant males, many PKD-2::GFP-labeled puncta accumulate along the distal dendrite. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ubi-PKD-2::GFP localizes to the ciliary bases of CEM and RnB neurons in the stam-1 mutant. In the stam-1 mutant, fluorescence intensity values for Ubi-PKD-2::GFP at the ciliary base increased 10-fold compared with a wild-type background. In RnB neurons, Ubi-PKD-2::GFP puncta are also observed in the distal dendrite. | In stam-1 animals, PKD(S534D)::GFP localizes to the ciliary base, and the fluorescence intensity ratios for PKD-2(S534D)::GFP increase about five-fold. Strikingly, wild-type PKD-2::GFP, Ubi-PKD-2::GFP, and PKD-2(S534D)::GFP accumulate at the stam-1(ok406) ciliary base in a similar pattern. | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005246 | PATO:0000460 | Paper_evidence | WBPaper00030801 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006973 | PATO:0000460 | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stam-1(ok406) hermaphrodites produce greater than 80% unfertilized and dead eggs. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004030 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stam-1(ok406) adult males exhibit a slight, but statistically significant defect in the response step of mating behavior. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Escapers exhibit normal locomotion. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000659 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Escapers exhibit normal feeding. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hgrs-1 levels are normal in the stam-1 mutant background (data not shown). | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000853 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2 dendritic motility is intact. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Escapers exhibit normal food sensation. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001816 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Escapers exhibit normal egg laying behavior. | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00030801 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sensory cilia of stam-1 mutants are intact as judged by fluorescent dye filling of amphid and phasmid neurons (data not shown). | Paper_evidence | WBPaper00030801 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:0080322 | |||||||
Models_disease_in_annotation | WBDOannot00000002 | ||||||||
Reference | WBPaper00040092 | ||||||||
WBPaper00027739 | |||||||||
WBPaper00030801 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |