WormBase Tree Display for Variation: WBVar00091752
expand all nodes | collapse all nodes | view schema
WBVar00091752 | Evidence | Paper_evidence | WBPaper00038487 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok461 | |||||
HGVSg | CHROMOSOME_X:g.1916677_1917838del | ||||||
Sequence_details | SMap | S_parent | Sequence | ZC53 | |||
Flanking_sequences | tattaaagcgttgccggagtgattgatagg | aaaaaataagttaagttttttaaaatcacc | |||||
Mapping_target | ZC53 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK461_external | ||||||
OK461_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031436 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00004352 | |||||
WBGene00022512 | |||||||
Transcript | ZC53.7.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
Intron_number | 5/6 | ||||||
Exon_number | 6-7/7 | ||||||
ZC53.6.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
Intron_number | 1/5 | ||||||
Exon_number | 1/6 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 5037 | ||||
Description | Phenotype_not_observed | WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038487 | ||||||
Remark | Last updated on 29 Nov 2002 | ||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |