WormBase Tree Display for Variation: WBVar00091768
expand all nodes | collapse all nodes | view schema
WBVar00091768 | Name | Public_name | ok480 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T07A9.6.1:c.1518_2370+52del | |||||||
HGVSg | CHROMOSOME_IV:g.421512_422467del | |||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | ||||
Flanking_sequences | ggtgagtagattgaggggtcccgcatataa | actggaaatgtgagaacatgttcctcagct | ||||||
Mapping_target | T07A9 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK480_external | |||||||
OK480_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000135 | |||||||
WBStrain00031447 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000913 | ||||||
Transcript | T07A9.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T07A9.6.1:c.1518_2370+52del | |||||||
cDNA_position | 1547-? | |||||||
CDS_position | 1518-? | |||||||
Protein_position | 506-? | |||||||
Intron_number | 5-6/8 | |||||||
Exon_number | 5-6/9 | |||||||
Interactor | WBInteraction000518922 | |||||||
WBInteraction000525390 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000124 | Paper_evidence | WBPaper00035407 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | daf-18 mutants display decreased activated MAPK expression compared to control | Paper_evidence | WBPaper00035407 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035407 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Staining with activated MAPK antibody | Paper_evidence | WBPaper00035407 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | daf-18(ok480) mutant animals display an enhanced aversion response to copper, compared to wild type animals (Figure 2B) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00027346 | ||||||
Curator_confirmed | WBPerson187 | |||||||
Remark | germline proliferation even when hatched in M9 with or without 0.08% ethanol. (Figure 2) | Paper_evidence | WBPaper00027346 | |||||
Curator_confirmed | WBPerson187 | |||||||
Phenotype_assay | Treatment | Also see "Starving Worms to Score Germline Proliferation" in the Supplemental Experimental Procedures | Paper_evidence | WBPaper00027346 | ||||
Curator_confirmed | WBPerson187 | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00046188 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 5E, S5B | Paper_evidence | WBPaper00046188 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00035407 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | daf-18(ok480) lacked detectable levels of DAF-18/PTEN protein | Paper_evidence | WBPaper00035407 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035407 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Western blots with DAF-18 antibody | Paper_evidence | WBPaper00035407 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was impaired in daf-18(ok480) insulin-like signaling pathway mutants, resulting in fewer animals crossing the copper barrier to get to the diacetyl spot than in wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002256 | Paper_evidence | WBPaper00044686 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Remark | Increased sensitivity to movement decline in response to selenium exposure. | Paper_evidence | WBPaper00044686 | |||||
Curator_confirmed | WBPerson1754 | |||||||
Required for the protective effect of glutathione in selenium exposed animals. | Paper_evidence | WBPaper00044686 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00044686 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on transgene analysis with a reporter. | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | germline is immortal at 20 and 25 degrees Celsius | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "... AGE-1 and DAF-18, which produce and hydrolyze PtdIns(3,4,5) P3, respectively, or R01H10.7, an INPP4A homologue that dephosphorylates PtdIns(3,4)P2, are all dispensable for apoptotic cell clearance (Fig S1, R-X)." | Paper_evidence | WBPaper00048406 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Mutant animals exhibit a wild type frequency of body bends (Figure 3A) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Disease_info | Models_disease | DOID:162 | ||||||
Modifies_disease | DOID:0080001 | |||||||
Models_disease_in_annotation | WBDOannot00001095 | |||||||
Modifies_disease_in_annotation | WBDOannot00000565 | |||||||
Reference | WBPaper00037970 | |||||||
WBPaper00027346 | ||||||||
WBPaper00028886 | ||||||||
WBPaper00028759 | ||||||||
WBPaper00035407 | ||||||||
WBPaper00044686 | ||||||||
WBPaper00046188 | ||||||||
WBPaper00048406 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |