WormBase Tree Display for Variation: WBVar00091777

WBVar00091777 Name: Public_name: ok489
    Other_name: CE54142:p.Ser300ArgfsTer8
      R01H10.7.1:c.897_1825del
    HGVSg: CHROMOSOME_III:g.10263120_10264885del
  Sequence_details: SMap: S_parent: Sequence: R01H10
    Flanking_sequences: tgaattcagatgtccatttgatatgatctg ccagcagtgataaaatcccgtttatcactg
    Mapping_target: R01H10
    Type_of_mutation: Deletion
    PCR_product: OK489_external
      OK489_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031448
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00010975
    Transcript: R01H10.7.1 (11)
  Isolation: Mutagen: UV/TMP
  Description: Phenotype_not_observed: WBPhenotype:0001180 Paper_evidence: WBPaper00048406
        Curator_confirmed: WBPerson2987
        Remark: "... AGE-1 and DAF-18, which produce and hydrolyze PtdIns(3,4,5) P3, respectively, or R01H10.7, an INPP4A homologue that dephosphorylates PtdIns(3,4)P2, are all dispensable for apoptotic cell clearance (Fig S1, R-X)." Paper_evidence: WBPaper00048406
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00048406
  Remark: Last updated on 29 Nov 2002
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele