WormBase Tree Display for Variation: WBVar00091798
expand all nodes | collapse all nodes | view schema
WBVar00091798 | Name | Public_name | ok511 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.11966426_11967166delinsCTCCAACAAGCTACTGC | |||||||
Sequence_details | SMap | S_parent | Sequence | W03C9 | ||||
Flanking_sequences | agtttttttacagaaaaaatgtgatttttc | aattcctccaacaagctactgcatgtcctt | ||||||
Mapping_target | W03C9 | |||||||
Type_of_mutation | Insertion | CTCCAACAAGCTACTGC | ||||||
Deletion | ||||||||
PCR_product | ok511_external | |||||||
ok511_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035667 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00012221 | ||||||
WBGene00004271 | ||||||||
Transcript | W03C9.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-4/6 | |||||||
Exon_number | 1-4/7 | |||||||
W03C9.5.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 285-? | |||||||
Exon_number | 5/5 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4619 | |||||
Description | Phenotype | WBPhenotype:0000736 | Paper_evidence | WBPaper00040312 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The disappearance of MitoTracker Red-labeled sperm mitochondria was inhibited in rab-7(ok511) null mutant embryos. | Paper_evidence | WBPaper00040312 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001135 | Paper_evidence | WBPaper00040312 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Paternal mitochondria persisted. | Paper_evidence | WBPaper00040312 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | In rab-7(ok511) mutant worms, corpses were arrested in AO-negative phagosomes | Paper_evidence | WBPaper00031805 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000706 | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations did not result in Glo phenotypes | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00040312 | |||||||
WBPaper00031805 | ||||||||
WBPaper00025094 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |