WormBase Tree Display for Variation: WBVar00091816
expand all nodes | collapse all nodes | view schema
WBVar00091816 | Name | Public_name | ok529 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F21H11.3.1:c.531+161_678+301del | ||||||||
HGVSg | CHROMOSOME_III:g.5132260_5133341del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F21H11 | |||||
Flanking_sequences | ttccagtttttgctttaaaaaacttccaaa | tgaaatgattggtggccaaaaggattactg | |||||||
Mapping_target | F21H11 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok529_external | ||||||||
ok529_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035675 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006543 | |||||||
Transcript | F21H11.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F21H11.3.1:c.531+161_678+301del | ||||||||
Intron_number | 4-5/6 | ||||||||
Exon_number | 5/7 | ||||||||
Interactor | WBInteraction000502644 | ||||||||
WBInteraction000502645 | |||||||||
WBInteraction000502646 | |||||||||
WBInteraction000502647 | |||||||||
WBInteraction000520057 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4725 | ||||||
Description | Phenotype | WBPhenotype:0000081 | Paper_evidence | WBPaper00031910 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Predicted null. | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00031910 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000816 | Paper_evidence | WBPaper00031910 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Predicted null. Animals had similar HSN and PHB defects to tbx-2( gm111) animals. | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00031910 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | gmIs13(srb-6Tgfp) | Paper_evidence | WBPaper00031910 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00031910 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSNs were observed to migrate prematurely and were displaced posteriorly. | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00031910 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kyIs179[Punc-86::gfp] | Paper_evidence | WBPaper00031910 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001333 | Paper_evidence | WBPaper00031910 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are missing PHB phasmid neurons as assayed by quantifiying the number of gmIs13 reporter expressing phasmids. This phenotype is rescued by mutations in cell death promoting genes, ced-3, ced-4 or egl-1. | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031910 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00031910 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | gmIs13 | Paper_evidence | WBPaper00031910 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00025775 | ||||||||
WBPaper00031910 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |