WormBase Tree Display for Variation: WBVar00091826
expand all nodes | collapse all nodes | view schema
WBVar00091826 | Evidence | Paper_evidence | WBPaper00032244 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok539 | |||||
Other_name | Y57G11C.24o.1:c.2077+238_2078-33del | ||||||
Y57G11C.24e.1:c.1318+238_1319-33del | |||||||
Y57G11C.24n.1:c.2152+238_2153-33del | |||||||
Y57G11C.24g.1:c.2074+238_2075-33del | |||||||
Y57G11C.24k.1:c.1933+238_1934-33del | |||||||
Y57G11C.24d.1:c.1858+238_1859-33del | |||||||
Y57G11C.24j.1:c.1984+238_1985-33del | |||||||
Y57G11C.24a.1:c.1909+238_1910-33del | |||||||
Y57G11C.24i.1:c.2149+238_2150-33del | |||||||
Y57G11C.24l.1:c.1393+238_1394-33del | |||||||
HGVSg | CHROMOSOME_IV:g.14896364_14897288del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y57G11C | |||
Flanking_sequences | caaattcaaattcaaaaaattgccaaaatg | aaactgtaaaaaaaatattcccaaatttcc | |||||
Mapping_target | Y57G11C | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK539_external | ||||||
OK539_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031465 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00048249 | |||||
WBGene00171397 | |||||||
WBGene00048067 | |||||||
WBGene00001330 | |||||||
Transcript (14) | |||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 4290 | ||||
Description | Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00032244 | |||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000750 | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Phenotypically silent allele. Participated in genetic interactions, i.e. enhanced embryonic lethality of vab-19(e1056cs) at nonpermissive temperatures. | Paper_evidence | WBPaper00032244 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00032244 | ||||||
Remark | Last updated on 29 Nov 2002 | ||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |