WormBase Tree Display for Variation: WBVar00091838
expand all nodes | collapse all nodes | view schema
WBVar00091838 | Name | Public_name | ok551 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F45E6.2.1:c.830_1684-64del | |||||||
HGVSg | CHROMOSOME_X:g.12482223_12484122del | |||||||
Sequence_details | SMap | S_parent | Sequence | F45E6 | ||||
Flanking_sequences | agaaggaagccgatgaacatatgaaaatga | tgtgcagcttttagctagattcatatgtag | ||||||
Mapping_target | F45E6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK551_external | |||||||
OK551_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031485 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000222 | ||||||
Transcript | F45E6.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F45E6.2.1:c.830_1684-64del | |||||||
cDNA_position | 830-? | |||||||
CDS_position | 830-? | |||||||
Protein_position | 277-? | |||||||
Intron_number | 5-9/10 | |||||||
Exon_number | 5-9/11 | |||||||
Interactor | WBInteraction000501560 | |||||||
WBInteraction000520460 | ||||||||
WBInteraction000520496 | ||||||||
WBInteraction000520567 | ||||||||
WBInteraction000536401 | ||||||||
WBInteraction000536416 | ||||||||
WBInteraction000536419 | ||||||||
WBInteraction000536435 | ||||||||
WBInteraction000536444 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00036076 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." | Paper_evidence | WBPaper00036076 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00035294 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In the control wild-type N2 worms, expression of ubiquilin and erasin transcripts increased after 6 h of tunicamycin treatment (Fig. 8). However, the induction of both genes was almost completely attenuated in ire-1(v33) mutant worms, and partially attenuated in the atf-6(ok551) and pek-1(ok275) mutants (Fig. 8). Together, these results indicate that in C. elegans, both ubiquilin and erasin genes are chiefly regulated by ire-1." | Paper_evidence | WBPaper00035294 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00035294 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00045849 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | A high level of hsp-4 expression is observed in a atf-6(ok551) mutant background. | Paper_evidence | WBPaper00045849 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00041022 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "While several of the tested genes had an effect (results not shown), hsp-3 stood out for its strong effect, essentially totally blocking the induction of pnlp-29::GFP normally observed upon infection in adult worms (Fig. 2A). A similar abrogation of reporter gene expression was seen in an atf-6 mutant, but not in a pek-1 mutant background (Fig. S1)." | Paper_evidence | WBPaper00041022 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00041022 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002058 | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In the presence of low to moderate levels of the pore forming toxin (PFT) Cry5B, wild-type worms are slightly intoxicated compared to those found on control no-toxin plates, as evidenced by their smaller sizes and paler appearances. However, the mutant worms are more severely intoxicated than wild-type worms as they are relatively smaller and considerably paler compared to their corresponding no toxin controls. Compared to N2 and pek-1(ok275) animals, mutants were Hpo, i.e., more developmentally inhibited by Cry5B than wild-type animals. | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00032255 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002422 | Paper_evidence | WBPaper00036076 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "The ire-1 ( v33 ) and pek-1 ( ok275 ) mutant strains are more sensitive to tunicamycin than the wild-type ( Figure 3A , bars ; Shen et al . , 2001 ) , whereas atf-6 ( ok551 ) worms are less sensitive to tunicamycin ( Shen et al. , 2005 ) , and in our hands are more resistant than the wild type ( Figure 3A , bars ) ." | Paper_evidence | WBPaper00036076 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00036076 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Tunicamycin (Tm) preconditioning in wild type worms leads to increased tolerance to hypoxia. "... three loss-of-function mutant alleles of ire-1 (Fig. 3B), two alleles of atf-6 (Fig. 3D), and an allele of xbp-1 (Fig. 3F) all were defective for Tm preconditioning (Fig. 2D)." | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00037064 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed (11) | ||||||||
Reference (12) | ||||||||
Remark | Last updated on 29 Nov 2002 | |||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |