WormBase Tree Display for Variation: WBVar00091859
expand all nodes | collapse all nodes | view schema
WBVar00091859 | Name | Public_name | ok573 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_V:g.6431141_6432609delinsTT | ||||
Sequence_details | SMap | S_parent | Sequence | T05H4 | |
Flanking_sequences | ttttaaaagtgaacctgatcccgattggat | attagctccttttgttttgatgactttcct | |||
Mapping_target | T05H4 | ||||
Type_of_mutation | Insertion | tt | |||
Deletion | |||||
PCR_product | OK573_external | ||||
OK573_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00035681 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00001513 | |||
Transcript | T05H4.14.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | 841-? | ||||
CDS_position | 832-? | ||||
Protein_position | 278-? | ||||
Intron_number | 3-5/6 | ||||
Exon_number | 3-7/7 | ||||
Reference | WBPaper00061173 | ||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Method | KO_consortium_allele |