WormBase Tree Display for Variation: WBVar00091864
expand all nodes | collapse all nodes | view schema
WBVar00091864 | Evidence | Paper_evidence | WBPaper00040220 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok578 | |||||||
Other_name | F25D1.1c.1:c.190_820-167delinsTT | ||||||||
F25D1.1b.1:c.136_766-167delinsTT | |||||||||
F25D1.1a.1:c.439_1069-167delinsTT | |||||||||
HGVSg | CHROMOSOME_V:g.10533887_10534870delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | F25D1 | |||||
Flanking_sequences | atgccacgtggaaggtttaaaatggataaa | tccatcgaaaacggcaaagaatgaccaatc | |||||||
Mapping_target | F25D1 | ||||||||
Type_of_mutation | Insertion | AA | |||||||
Deletion | |||||||||
PCR_product | ok578_external | ||||||||
ok578_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035646 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006460 | |||||||
Transcript | F25D1.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D1.1c.1:c.190_820-167delinsTT | ||||||||
cDNA_position | 190-? | ||||||||
CDS_position | 190-? | ||||||||
Protein_position | 64-? | ||||||||
Intron_number | 3-5/5 | ||||||||
Exon_number | 3-5/6 | ||||||||
F25D1.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D1.1b.1:c.136_766-167delinsTT | ||||||||
cDNA_position | 283-? | ||||||||
CDS_position | 136-? | ||||||||
Protein_position | 46-? | ||||||||
Intron_number | 4-6/6 | ||||||||
Exon_number | 4-6/7 | ||||||||
F25D1.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D1.1a.1:c.439_1069-167delinsTT | ||||||||
cDNA_position | 843-? | ||||||||
CDS_position | 439-? | ||||||||
Protein_position | 147-? | ||||||||
Intron_number | 5-7/8 | ||||||||
Exon_number | 5-7/9 | ||||||||
Interactor | WBInteraction000518356 | ||||||||
WBInteraction000518373 | |||||||||
WBInteraction000518374 | |||||||||
WBInteraction000518375 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000633 | Paper_evidence | WBPaper00040220 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ppm-1(lf) animals had defects in synaptic branch extension that were very low penetrance. | Paper_evidence | WBPaper00040220 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00040220 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002069 | Paper_evidence | WBPaper00040220 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants display two types of ALM axon termination defects: less severe short hooks and more severe big hooks where the axon overextends and hooks toward the posterior of the animal. Big hooks is the predominant phenotype on mutants. Small hook defects occurred with low penetrance. | The majority of PLM neurons in rpm-1(lf) mutants (90%) display a more severe phenotype in which the PLM axon overextends beyond the ALM cell body and also hooks ventrally. | Paper_evidence | WBPaper00040220 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00040220 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00040220 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00040220 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | SNB::GFP puncta were normal | Paper_evidence | WBPaper00040220 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040220 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |