WormBase Tree Display for Variation: WBVar00091903
expand all nodes | collapse all nodes | view schema
WBVar00091903 | Name | Public_name | ok619 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.9782936_9783877del | ||||
Sequence_details | SMap | S_parent | Sequence | R10E11 | |
Flanking_sequences | CCCTTTCCAATCATCAGCACTTGACCGATACAGTCAACGCATCTCAGTTG | AACAACATTTTAAAACCCGATGAAAATTGTGCAAAAACAAAAGTTTGAAA | |||
Mapping_target | R10E11 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00031520 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00006911 | |||
WBGene00011218 | |||||
Transcript | R10E11.2.1 | VEP_consequence | 3_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
cDNA_position | 676-? | ||||
Exon_number | 5/5 | ||||
R10E11.6a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 2/6 | ||||
Exon_number | 1-2/7 | ||||
R10E11.6b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 1/3 | ||||
Exon_number | 1/4 | ||||
R10E11.6a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 1-3/7 | ||||
Exon_number | 1-3/8 | ||||
Isolation | Mutagen | UV/TMP | |||
Genetics | Mapping_data | In_multi_point | 5015 | ||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf268022 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |