WormBase Tree Display for Variation: WBVar00091905
expand all nodes | collapse all nodes | view schema
WBVar00091905 | Name | Public_name | ok621 | ||||
---|---|---|---|---|---|---|---|
Other_name | F42G9.9d.1:c.-78+9_*280delinsT | ||||||
F42G9.9d.3:c.-78+9_*280delinsT | |||||||
F42G9.9a.1:c.367+9_1352delinsT | |||||||
F42G9.9d.2:c.-78+9_*233delinsT | |||||||
F42G9.9b.1:c.367+9_1195-186delinsT | |||||||
F42G9.9c.1:c.367+9_1195-197delinsT | |||||||
HGVSg | CHROMOSOME_III:g.768867_770799delinsT | ||||||
Sequence_details | SMap | S_parent | Sequence | F42G9 | |||
Flanking_sequences | AAGGAAGAAGAAGTTGTAGTCGGTAGGTTT | CTCGTTATGATCGGACCACGCTTTCACTTG | |||||
Mapping_target | F42G9 | ||||||
Type_of_mutation | Insertion | t | |||||
Deletion | |||||||
PCR_product | OK621_external | ||||||
OK621_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031522 | ||||||
Component_of_genotype | WBGenotype00000079 | ||||||
WBGenotype00000080 | |||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00004212 | |||||
Transcript | F42G9.9d.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F42G9.9d.2:c.-78+9_*233delinsT | ||||||
cDNA_position | ?-1370 | ||||||
Intron_number | 1-7/7 | ||||||
Exon_number | 2-8/8 | ||||||
F42G9.9d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F42G9.9d.1:c.-78+9_*280delinsT | ||||||
cDNA_position | ?-1417 | ||||||
Intron_number | 1-5/6 | ||||||
Exon_number | 2-7/7 | ||||||
F42G9.9c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F42G9.9c.1:c.367+9_1195-197delinsT | ||||||
Intron_number | 3-7/8 | ||||||
Exon_number | 4-7/9 | ||||||
F42G9.9a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F42G9.9a.1:c.367+9_1352delinsT | ||||||
cDNA_position | ?-1357 | ||||||
CDS_position | ?-1352 | ||||||
Protein_position | ?-451 | ||||||
Intron_number | 3-8/9 | ||||||
Exon_number | 4-9/10 | ||||||
F42G9.9b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F42G9.9b.1:c.367+9_1195-186delinsT | ||||||
Intron_number | 3-7/8 | ||||||
Exon_number | 4-7/9 | ||||||
F42G9.9d.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F42G9.9d.3:c.-78+9_*280delinsT | ||||||
cDNA_position | ?-1481 | ||||||
Intron_number | 2-6/7 | ||||||
Exon_number | 3-8/8 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 4612 | ||||
Description | Phenotype | WBPhenotype:0001332 | Paper_evidence | WBPaper00038442 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | No significant differences regarding vesicle accumulation in cell bodies between wildtype and mutants were observed. | Paper_evidence | WBPaper00038442 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001752 | Paper_evidence | WBPaper00038442 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Synaptic vesicles seem to travel further distances in mutants, while the overall vesicle density is increased in mutants. | Paper_evidence | WBPaper00038442 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002039 | Paper_evidence | WBPaper00038442 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | ptl-1 knockout rather affects retrograde than anterograde movements of UNC-104 or SNB-1. An obvious effect can be seen in retrograde pausing, run length, and motor/cargo reversals. | Paper_evidence | WBPaper00038442 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0001477 | Paper_evidence | WBPaper00038442 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | ptl-1 knockout rather affects retrograde than anterograde movements of UNC-104 or SNB-1. | Paper_evidence | WBPaper00038442 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002127 | Paper_evidence | WBPaper00038442 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The velocity of both the motor and its cargo was not affected. | Paper_evidence | WBPaper00038442 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
Disease_info | Models_disease | DOID:332 | |||||
DOID:680 | |||||||
Models_disease_in_annotation | WBDOannot00000145 | ||||||
WBDOannot00001034 | |||||||
Reference | WBPaper00038487 | ||||||
WBPaper00038442 | |||||||
Remark | Last updated on 29 Nov 2002 | ||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |