WormBase Tree Display for Variation: WBVar00091908
expand all nodes | collapse all nodes | view schema
| WBVar00091908 | Evidence | Paper_evidence | WBPaper00038487 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok624 | |||||
| Other_name | F56E3.4b.1:c.50-21_775del | ||||||
| F56E3.4a.1:c.50-21_775del | |||||||
| HGVSg | CHROMOSOME_X:g.3197904_3198851del | ||||||
| Sequence_details | SMap | S_parent | Sequence | F56E3 | |||
| Flanking_sequences | tacaacataccttctcagaatttgtgagca | attggaaaacagttttccatctctattctc | |||||
| Mapping_target | F56E3 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok624_external | ||||||
| ok624_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00031525 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001400 | |||||
| Transcript | F56E3.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F56E3.4b.1:c.50-21_775del | ||||||
| cDNA_position | ?-835 | ||||||
| CDS_position | ?-775 | ||||||
| Protein_position | ?-259 | ||||||
| Intron_number | 2-6/9 | ||||||
| Exon_number | 3-7/10 | ||||||
| F56E3.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F56E3.4a.1:c.50-21_775del | ||||||
| cDNA_position | ?-807 | ||||||
| CDS_position | ?-775 | ||||||
| Protein_position | ?-259 | ||||||
| Intron_number | 2-6/8 | ||||||
| Exon_number | 3-7/9 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibited an increase in habituation in response to continued plate taps applied with a 10s interval, compared to N2 animals. | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibit a lower probability of escape responses (reversal) compared to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00038487 | ||||||
| Remark | Last updated on 29 Nov 2002 | ||||||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
| Method | KO_consortium_allele |
