WormBase Tree Display for Variation: WBVar00091935
expand all nodes | collapse all nodes | view schema
| WBVar00091935 | Evidence | Paper_evidence | WBPaper00033444 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok651 | |||||
| HGVSg | CHROMOSOME_IV:g.2113133_2114191del | ||||||
| Sequence_details | SMap | S_parent | Sequence | C23H5 | |||
| Flanking_sequences | cgtggcgagacctaacaatgtgaatttttt | agtaccccgaccatatcccaccactaaccc | |||||
| Mapping_target | C23H5 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok651_external | ||||||
| ok651_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00031540 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00016027 | |||||
| Transcript | C23H5.8c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/5 | ||||||
| Exon_number | 1-2/6 | ||||||
| C23H5.8b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/5 | ||||||
| Exon_number | 1-2/6 | ||||||
| C23H5.8a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/6 | ||||||
| Exon_number | 1-2/7 | ||||||
| C23H5.8b.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/6 | ||||||
| Exon_number | 1-2/7 | ||||||
| C23H5.8d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2/6 | ||||||
| Exon_number | 1-2/7 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Null | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00033444 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
