WormBase Tree Display for Variation: WBVar00091940
expand all nodes | collapse all nodes | view schema
WBVar00091940 | Name | Public_name | ok656 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T07C4.2.1:c.182_829del | ||||||||
T07C4.2.2:c.182_829del | |||||||||
CE36891:p.Pro61_Ter277delinsGln | |||||||||
HGVSg | CHROMOSOME_III:g.10347765_10349482del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | |||||
Flanking_sequences | agctctacgctatgatgcttcatattgagc | aattcccatttggacttccatgcttctccc | |||||||
Mapping_target | T07C4 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok656_external | ||||||||
ok656_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031544 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006545 | |||||||
Transcript | T07C4.2.1 (11) | ||||||||
T07C4.2.2 (11) | |||||||||
Interactor | WBInteraction000007723 | ||||||||
WBInteraction000052316 | |||||||||
WBInteraction000052317 | |||||||||
WBInteraction000521960 | |||||||||
WBInteraction000521963 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4790 | ||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00040526 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Upregulated expression of tbx-9::gfp predicted the phenotypic outcome of the tbx-8 mutation. | The daf-21::mCherry reporter predicted the tbx-8(ok656) mutation morphological outcome. | Paper_evidence | WBPaper00040526 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00040526 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00040526 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00025190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000189 | Paper_evidence | WBPaper00006477 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Lateral hypodermal cells are disorganized as assayed by the pattern of AJM::GFP expression in hypodermal cells in 48% (n=54) embryos scored. | Paper_evidence | WBPaper00006477 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00006477 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000018 | PATO:0000460 | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | AJM::GFP | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00006477 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 1.6% (n=1071)eggs were unable to hatch, compared with 0.6% dpy-17/+ ok656/+ (n=574)and 1.1% dpy-17/+ (n=284) unable to hatch. | Paper_evidence | WBPaper00006477 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00006477 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00006477 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000535 | Paper_evidence | WBPaper00006477 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 3.5% of animals exhibited disorganized body morphology in < half their body length. 0.7% animals exhibited disorganized body morphology > half their body length (n=1071). | Paper_evidence | WBPaper00006477 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00006477 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000793 | Paper_evidence | WBPaper00025190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00040526 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited upregulated expression of tbx-9::gfp. | Paper_evidence | WBPaper00040526 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00040526 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00040526 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040526 | ||||||||
WBPaper00018977 | |||||||||
WBPaper00025190 | |||||||||
WBPaper00006477 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |