WormBase Tree Display for Variation: WBVar00091944

WBVar00091944 Evidence: Paper_evidence: WBPaper00031945
  Name: Public_name: ok660
    Other_name: E03A3.2.1:c.957-75_1528del
    HGVSg: CHROMOSOME_III:g.4055071_4056369del
  Sequence_details: SMap: S_parent: Sequence: E03A3
    Flanking_sequences: ctcttccagctcttccggcttcttgataat ttgataaagttttaacaaatgaaattttgg
    Mapping_target: E03A3
    Type_of_mutation: Deletion
    PCR_product: ok660_external
      ok660_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031548
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004322
    Transcript: E03A3.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: E03A3.2.1:c.957-75_1528del
        cDNA_position: ?-1528
        CDS_position: ?-1528
        Protein_position: ?-510
        Intron_number: 3-5/11
        Exon_number: 4-6/12
  Isolation: Mutagen: UV/TMP
  Description: Phenotype_not_observed: WBPhenotype:0001760 Paper_evidence: WBPaper00031945
        Curator_confirmed: WBPerson712
        Remark: MonoG or G-tracts were not deleted at an increased rate as demonstrated by lack of expression of B-galactosidase, which acted as an indicator of a DNA rearrangement bringing a LacZ start codon in-frame with the downstream ORF. No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. Paper_evidence: WBPaper00031945
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] Paper_evidence: WBPaper00031945
              Curator_confirmed: WBPerson712
  Reference: WBPaper00031945
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele