WormBase Tree Display for Variation: WBVar00091952
expand all nodes | collapse all nodes | view schema
WBVar00091952 | Name | Public_name | ok668 | ||
---|---|---|---|---|---|
Other_name | F14B8.1a.1:c.195-182_846delinsT | ||||
HGVSg | CHROMOSOME_X:g.6917146_6918335delinsT | ||||
Sequence_details | SMap | S_parent | Sequence | F14B8 | |
Flanking_sequences | TATTGGTGTTTTCCAACACAATATACTTGTGTATCAATAGGGCCGGTCTA | GATGAGATGCTTACAATTACTTCGGTCGTTGGAAGTTGCGTTGTACAGTT | |||
Mapping_target | F14B8 | ||||
Type_of_mutation | Insertion | T | |||
Deletion | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00031554 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00003732 | |||
Transcript | F14B8.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F14B8.1a.1:c.195-182_846delinsT | ||||
cDNA_position | ?-932 | ||||
CDS_position | ?-846 | ||||
Protein_position | ?-282 | ||||
Intron_number | 4-5/14 | ||||
Exon_number | 5-6/15 | ||||
F14B8.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-652 | ||||
CDS_position | ?-651 | ||||
Protein_position | ?-217 | ||||
Intron_number | 2/11 | ||||
Exon_number | 1-3/12 | ||||
Isolation | Mutagen | UV/TMP | |||
Genetics | Mapping_data | In_multi_point | 4531 | ||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf268364 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |