WormBase Tree Display for Variation: WBVar00091969
expand all nodes | collapse all nodes | view schema
WBVar00091969 | Name | Public_name | ok685 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y32F6B.3.1:c.57-273_186+256delinsTTCTT | ||||||||
HGVSg | CHROMOSOME_V:g.10479248_10479906delinsTTCTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y32F6B | |||||
Flanking_sequences | tgagattatcccacagaatgtttcttattt | acattgaagaacaaacgctaaaaaaaccat | |||||||
Mapping_target | Y32F6B | ||||||||
Type_of_mutation | Insertion | TTCTT | |||||||
Deletion | |||||||||
PCR_product | ok685_external | ||||||||
ok685_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031568 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00012532 | |||||||
WBGene00196118 | |||||||||
Transcript | Y32F6B.5 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
Y32F6B.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y32F6B.3.1:c.57-273_186+256delinsTTCTT | ||||||||
Intron_number | 2-3/5 | ||||||||
Exon_number | 3/6 | ||||||||
Interactor | WBInteraction000502102 | ||||||||
WBInteraction000542206 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 5081 | ||||||
Description | Phenotype | WBPhenotype:0001370 | Paper_evidence | WBPaper00031857 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The functional complex between P97/VCP/CDC-48 and CRP-1 was absent in CPR-1mutant worm lysates | Paper_evidence | WBPaper00031857 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Lysates containing GST-CRP-1 were mixed with His6-P97/VCP/CDC-48-containing lysate, followed by GST pull-down assays. | Paper_evidence | WBPaper00031857 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00031857 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Attenuated expression of xbp-1 and ckb-2 and increased expression of hsp-4 and F22E5.6 in crp-1mutants compared to wild-type. xbp-1 mRNA splicing was slightly attenuated upon TM treatment in crp-1 mutants | Paper_evidence | WBPaper00031857 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | tunicamycin treatment followed by RT-PCR of UPR target genes | Paper_evidence | WBPaper00031857 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001724 | Paper_evidence | WBPaper00031857 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | crp-1 mutants were more sensitive to Tunicamycin than N2 worms. At 2 ug/ml of TM, more than 60% of all the crp-1mutants were arrested at the L1 stage | Paper_evidence | WBPaper00031857 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 0-10 ug/ml tunicamycin | Paper_evidence | WBPaper00031857 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001833 | Paper_evidence | WBPaper00025137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | CHE-14 trafficking appeared to be altered significantly in crp-1(ok685) animals in both vulval and rectal epithelia. The distribution of C6-NBD ceramide was also altered. However, myotactin, IFB-2 and AJM-1 distribution was unaffected in crp-1(ok685) mutants | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005800 | PATO:0000460 | Paper_evidence | WBPaper00025137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007831 | PATO:0000460 | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | MH46, MH33 and MH27antibody staining. C6-NBD-ceramide distribution was observed by direct fluorescence microscopy after ingestion of exogenous C6-NBD-ceramide/bovine serum albumin complex by young adults for 2 h, followed by a 2-h washing with M9 buffer | Paper_evidence | WBPaper00025137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | Ex[CHE-14::GFP] | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000520 | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No obvious morphological abnormality | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00025137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00025137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00025137 | ||||||||
WBPaper00031857 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |