WormBase Tree Display for Variation: WBVar00091984
expand all nodes | collapse all nodes | view schema
WBVar00091984 | Evidence | Paper_evidence | WBPaper00025094 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok700 | ||||||
Other_name | T19E7.3a.1:c.500+222_943-242delinsAAAAAAAAGTTTG | |||||||
HGVSg | CHROMOSOME_IV:g.5661767_5663143delinsCAAACTTTTTTTT | |||||||
Sequence_details | SMap | S_parent | Sequence | T19E7 | ||||
Flanking_sequences | ttcacccaattatttaaataaaatttatta | cacaaactttttgagaaagcttcagagcat | ||||||
Mapping_target | T19E7 | |||||||
Type_of_mutation | Insertion | CAAACTTTTTTTT | ||||||
Deletion | ||||||||
PCR_product | ok700_external | |||||||
ok700_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035759 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00197238 | ||||||
WBGene00000247 | ||||||||
Transcript | T19E7.24 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
T19E7.3b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/1 | |||||||
Exon_number | 1/2 | |||||||
T19E7.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T19E7.3a.1:c.500+222_943-242delinsAAAAAAAAGTTTG | |||||||
Intron_number | 4-7/8 | |||||||
Exon_number | 5-7/9 | |||||||
Interactor | WBInteraction000504612 | |||||||
WBInteraction000525221 | ||||||||
WBInteraction000525247 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000679 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found that phagosomal association of GFP-RAB-5, which is recruited at early phagosome maturation stages, decreased significantly in bec-1(ok700) mutants (Figure 1G). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that phagosomal association of GFP-RAB-7, which is recruited at late phagosome maturation stages, decreased significantly in bec-1(ok700) mutants (Figure 1H). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phagosomal labeling by the lysosomal membrane protein LAAT-1 was reduced in bec-1(ok700) mutants (Figure 1I). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-RAB-5 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-7 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
LAAT-1-mCHERRY | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001181 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The bec-1(ok700) mutation resulted in a significant increase in the number of cell corpses observed in embryos (Table 1, Figure S1A,B) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found that phagosomal association of GFP-RAB-5, which is recruited at early phagosome maturation stages, decreased significantly in bec-1(ok700) mutants (Figure 1G). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that phagosomal association of GFP-RAB-7, which is recruited at late phagosome maturation stages, decreased significantly in bec-1(ok700) mutants (Figure 1H). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phagosomal labeling by the lysosomal membrane protein LAAT-1 was reduced in bec-1(ok700) mutants (Figure 1I). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-RAB-5 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-7 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
LAAT-1-mCHERRY | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002059 | Paper_evidence | WBPaper00050468 | ||||||
Curator_confirmed | WBPerson11549 | |||||||
Remark | Hypersensitive to Cry5B in life span (Fig. 2A) | Paper_evidence | WBPaper00050468 | |||||
Curator_confirmed | WBPerson11549 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050468 | ||||
Curator_confirmed | WBPerson11549 | |||||||
WBPhenotype:0002349 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found significantly reduced YFP-2xFYVE labeling of cell corpses in bec-1(ok700) mutants, suggesting that phosphatidylinositol 3-phosphate (PtdIns3P) generation and/or accumulation on phagosomes is affected (Figure 2A, B). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | YFP-2xFYVE, a marker for phosphatidylinositol 3-phosphate | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000706 | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations did not result in Glo phenotypes | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00025094 | |||||||
WBPaper00044390 | ||||||||
WBPaper00050468 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |