WormBase Tree Display for Variation: WBVar00091989
expand all nodes | collapse all nodes | view schema
WBVar00091989 | Name | Public_name | ok705 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_IV:g.17378126_17379461delinsGATATGTCCCGTATTGATAAGGTGACTTCCATAAAATAAGATCGAAGA | ||||||||
Sequence_details | SMap | S_parent | Sequence | C30H6 | |||||
Flanking_sequences | ggaagtcaccttatcaatacgggacatatc | acagctcccggtagctgggaaattgatcaa | |||||||
Mapping_target | C30H6 | ||||||||
Type_of_mutation | Insertion | GATATGTCCCGTATTGATAAGGTGACTTCCATAAAATAAGATCGAAGA | |||||||
Deletion | |||||||||
PCR_product | ok705_external | ||||||||
ok705_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031580 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00007826 | |||||||
WBGene00001811 | |||||||||
Transcript | C30H6.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 1057-? | ||||||||
CDS_position | 1048-? | ||||||||
Protein_position | 350-? | ||||||||
Intron_number | 7-9/10 | ||||||||
Exon_number | 7-11/11 | ||||||||
C30H6.9.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 546-? | ||||||||
CDS_position | 545-? | ||||||||
Protein_position | 182-? | ||||||||
Exon_number | 5-6/6 | ||||||||
Interactor (23) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype (14) | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00041370 | ||||||
WBPaper00045028 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... hsp-60pr::gfp induction caused by mitochondrial stresses that arrest worm development, such as treatment with EtBr (100 mg/ml) or spg-7(RNAi), did not require haf-1 (fig S8). Additionally, UPRmt activation caused by conditions that directly inhibited mitochondrial import, such as treatment with tomm-40(RNAi) (fig S8A), tim-23(RNAi), cco-1(RNAi), or paraquat (9), also did not require haf-1 (Fig 3A). " | Paper_evidence | WBPaper00041370 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
haf-1(ok705) did not affect expression of hsp-6p::GFP in response to cco-1 RNAi | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
haf-1(ok705) did not affect expression of hsp-6p::GFP in response to phb-2 RNAi | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | hsp-6p::gfp induction was measured 3 days from hatch at 20 degrees Celsius | Paper_evidence | WBPaper00045028 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00045028 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | hsp-60p::gfp | Paper_evidence | WBPaper00041370 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [hsp-6p::GFP]; cco-1(RNAi) | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [hsp-6p::GFP]; phb-2(RNAi) | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00035985 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By contrast, haf-1-deleted worms were indistinguishable from WT in their survival under reductive stress imposed by dithiothreitol (DTT), which promotes ER stress and activates the UPRER (Figure S2B)." | Paper_evidence | WBPaper00035985 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004908 | Paper_evidence | WBPaper00035985 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0042221 | PATO:0000460 | Paper_evidence | WBPaper00035985 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 5 millimolar dithiothreitol (DTT) and assayed for survival over several days | Paper_evidence | WBPaper00035985 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035985 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "the haf-1 deletion did not affect the nuclear distribution of DVE-1::GFP (Figure 6A), indicating that DVE-1 is not downstream of HAF-1 in UPRmt signaling and suggesting the existence of other UPRmt transcription factor(s) that had been missed in the original RNAi screen for genes that activate the UPRmt." | Paper_evidence | WBPaper00035985 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00035985 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Whereas the positive control, eri-1(mg366), markedly sensitized worms to dpy-13(RNAi), haf-1 deletion had no effect on the sensitivity of worms to the RNAi feeding procedure (Figure S1E)." | Paper_evidence | WBPaper00035985 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00035985 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Specificity for the UPRmt was revealed by the observation that induction of the UPRER was unaffected by haf-1 deletion (Figure 1D)." | Paper_evidence | WBPaper00035985 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0030968 | PATO:0000460 | Paper_evidence | WBPaper00035985 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002141 | Paper_evidence | WBPaper00035985 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By contrast, when exposed to the ER stress-inducing agent DTT, only minor differences in oxygen consumption were noted between WT and haf-1 mutant worms (Figure S2C)." | Paper_evidence | WBPaper00035985 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004908 | Paper_evidence | WBPaper00035985 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0072592 | PATO:0000460 | Paper_evidence | WBPaper00035985 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 5 millimolar dithiothreitol (DTT) and assayed for oxygen consumption | Paper_evidence | WBPaper00035985 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00041212 | ||||||||
WBPaper00041370 | |||||||||
WBPaper00027644 | |||||||||
WBPaper00035985 | |||||||||
WBPaper00043917 | |||||||||
WBPaper00045028 | |||||||||
WBPaper00049307 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |