WormBase Tree Display for Variation: WBVar00092001
expand all nodes | collapse all nodes | view schema
WBVar00092001 | Name | Public_name | ok719 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.6433128_6433954del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C05D11 | |||||
Flanking_sequences | atctacctttttcacaatttcgtaatcgca | gcatggacagccttccagcctcattcacaa | |||||||
Mapping_target | C05D11 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok719_external | ||||||||
ok719_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035863 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006515 | |||||||
WBGene00006516 | |||||||||
Transcript | C05D11.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-545 | ||||||||
CDS_position | ?-543 | ||||||||
Protein_position | ?-181 | ||||||||
Intron_number | 2-4/11 | ||||||||
Exon_number | 1-5/12 | ||||||||
C05D11.3.1 | VEP_consequence | 3_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 780-? | ||||||||
Exon_number | 5/5 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000103 | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The embryos of these mutant adults lacked birefringent gut granules | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00031805 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Accumulation of refractile apoptotic cells in the gonad in vps-16(ok719) mutants | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000706 | Paper_evidence | WBPaper00028972 | |||||||
WBPaper00025094 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
Remark | All of vps-16(ok719) adults had Glo phenotypes with a loss or significant reduction in the number of autofluorescent and acidic gut granules | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00025094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The embryos of these mutant adults arrested in early development | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00032272 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A large number of persistent germ-cell corpses were observed. | Paper_evidence | WBPaper00032272 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031805 | ||||||||
WBPaper00032272 | |||||||||
WBPaper00025094 | |||||||||
WBPaper00028972 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |