WormBase Tree Display for Variation: WBVar00092006
expand all nodes | collapse all nodes | view schema
WBVar00092006 | Evidence | Paper_evidence | WBPaper00033412 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok724 | ||||||
Other_name | R10E4.5d.1:c.193-153_482del | |||||||
R10E4.5a.1:c.178-153_467del | ||||||||
HGVSg | CHROMOSOME_III:g.4292192_4292984del | |||||||
Sequence_details | SMap | S_parent | Sequence | R10E4 | ||||
Flanking_sequences | cattctccccaagcaatttgcatgacgaga | ctgtaatgtcaaactgtcgttgatgcggga | ||||||
Mapping_target | R10E4 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok724_external | |||||||
ok724_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031590 | |||||||
Component_of_genotype | WBGenotype00000107 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00305560 | ||||||
WBGene00011201 | ||||||||
Transcript | R10E4.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-260 | |||||||
CDS_position | ?-260 | |||||||
Protein_position | ?-87 | |||||||
Intron_number | 1-2/4 | |||||||
Exon_number | 1-3/5 | |||||||
R10E4.13 | ||||||||
R10E4.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R10E4.5a.1:c.178-153_467del | |||||||
cDNA_position | ?-468 | |||||||
CDS_position | ?-467 | |||||||
Protein_position | ?-156 | |||||||
Intron_number | 2-4/7 | |||||||
Exon_number | 3-5/8 | |||||||
R10E4.5d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R10E4.5d.1:c.193-153_482del | |||||||
cDNA_position | ?-1322 | |||||||
CDS_position | ?-482 | |||||||
Protein_position | ?-161 | |||||||
Intron_number | 2-4/7 | |||||||
Exon_number | 3-5/8 | |||||||
R10E4.5c.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-8 | |||||||
CDS_position | ?-8 | |||||||
Protein_position | ?-3 | |||||||
Exon_number | 1/3 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0001016 | Paper_evidence | WBPaper00041521 | ||||
Curator_confirmed | WBPerson3701 | |||||||
Remark | normal rate of growth (compared to N2) to adulthood after exposure to hydrogen peroxide or methylmethanesulfonate. | Paper_evidence | WBPaper00041521 | |||||
Curator_confirmed | WBPerson3701 | |||||||
WBPhenotype:0001938 | Paper_evidence | WBPaper00041521 | ||||||
Curator_confirmed | WBPerson3701 | |||||||
Remark | same DNA repair rate in nuclear and mitochondrial genomes, after exposure to hydrogen peroxide or methylmethanesulfonate. | Paper_evidence | WBPaper00041521 | |||||
Curator_confirmed | WBPerson3701 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00033412 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nth-1mutants had a lifespan similar to N2 | Paper_evidence | WBPaper00033412 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00044630 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The nth-1(ok724) mutation did not significantly affect pmk-1 mRNA expression levels, compared to wild type controls, as determined by qRT-PCR (Figure S2) | Paper_evidence | WBPaper00044630 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000460 | Paper_evidence | WBPaper00033412 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nth-1mutants were not more sensitive to methyl viologen (compared to N2). | Paper_evidence | WBPaper00033412 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00033412 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001620 | Paper_evidence | WBPaper00033412 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nth-1mutants were not more sensitive to H2O2 (compared to N2). | Paper_evidence | WBPaper00033412 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info | Modifies_disease | DOID:14330 | ||||||
Modifies_disease_in_annotation | WBDOannot00001159 | |||||||
Reference | WBPaper00041521 | |||||||
WBPaper00033412 | ||||||||
WBPaper00044630 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |