WormBase Tree Display for Variation: WBVar00092016
expand all nodes | collapse all nodes | view schema
WBVar00092016 | Name | Public_name | ok734 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y76B12C.2.1:c.1575+342_1576-571del | |||||||
HGVSg | CHROMOSOME_IV:g.1997263_1998809del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y76B12C | ||||
Flanking_sequences | aaatgaaaattttcagacatttttgagctg | taatatgatggattacgggaatacaaaacc | ||||||
Mapping_target | Y76B12C | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok734_external | |||||||
ok734_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031598 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00022296 | ||||||
Transcript | Y76B12C.2.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y76B12C.2.1:c.1575+342_1576-571del | |||||||
Intron_number | 4/11 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0001756 | Paper_evidence | WBPaper00029176 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | xpc-1(ok734) mutants showed reduced germ cell apoptosis following UV-C treatment. | Paper_evidence | WBPaper00029176 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Germ cell apoptosis was measured following exposure to 100 joules per square meter UV-C. | Paper_evidence | WBPaper00029176 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000737 | Paper_evidence | WBPaper00029176 | |||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals homozygous for the xpc-1(ok734) mutation exhibited normal germ cell apoptosis in response to ionizing radiation. | Paper_evidence | WBPaper00029176 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Germ cell apoptosis was measured following exposure to X-rays (120 Gy). | Paper_evidence | WBPaper00029176 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00029176 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |