WormBase Tree Display for Variation: WBVar00092077
expand all nodes | collapse all nodes | view schema
WBVar00092077 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok797 | |||||||
Other_name | T26C12.4.1:c.934-513_1262del | ||||||||
HGVSg | CHROMOSOME_IV:g.3286289_3287130del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T26C12 | |||||
Flanking_sequences | ccagttgacagatctgtaacttgaagttcg | cactctttttttttaaaccgcccagtttgt | |||||||
Mapping_target | T26C12 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok797_external | ||||||||
ok797_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031636 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001548 | |||||||
Transcript | T26C12.4.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T26C12.4.1:c.934-513_1262del | ||||||||
cDNA_position | ?-1262 | ||||||||
CDS_position | ?-1262 | ||||||||
Protein_position | ?-421 | ||||||||
Intron_number | 5/9 | ||||||||
Exon_number | 6/10 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype_not_observed | WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Soluble guanylyl cyclases mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031936 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |