WormBase Tree Display for Variation: WBVar00092085

WBVar00092085 Name: Public_name: ok806
    Other_name: F19B6.4.1:c.971_1922del
      CE05669:p.Tyr324Ter
    HGVSg: CHROMOSOME_IV:g.12339008_12340251del
  Sequence_details: SMap: S_parent: Sequence: F19B6
    Flanking_sequences: tgatccttttatcgcaaggacacgtggcat gaaaatgtcgattgacagtaattgtactac
    Mapping_target: F19B6
    Type_of_mutation: Deletion
    PCR_product: ok806_external
      ok806_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031643
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008950
    Transcript: F19B6.4.1 (11)
  Isolation: Mutagen: UV/TMP
  Description: Phenotype_not_observed: WBPhenotype:0001208 Paper_evidence: WBPaper00027644
        Curator_confirmed: WBPerson557
        Remark: Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. Paper_evidence: WBPaper00027644
            Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. Paper_evidence: WBPaper00027644
              Curator_confirmed: WBPerson557
  Reference: WBPaper00027644
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele