WormBase Tree Display for Variation: WBVar00092089
expand all nodes | collapse all nodes | view schema
WBVar00092089 | Evidence | Paper_evidence | WBPaper00006450 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok810 | ||||||
HGVSg | CHROMOSOME_IV:g.1206891_1209106del | |||||||
Sequence_details | SMap | S_parent | Sequence | W09G12 | ||||
Flanking_sequences | atgcagcagaagctggcaaacattgcatta | tcggcagttgccgaagttgctgaactccaa | ||||||
Mapping_target | W09G12 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok810_external | |||||||
ok810_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008055 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001103 | ||||||
Transcript | W09G12.4.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 1-4/4 | |||||||
Description | Phenotype | WBPhenotype:0001998 | Paper_evidence | WBPaper00038282 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Among animals in which one VPC was isolated by laser ablation, the isolated VPC showed a strong decrease in secondary fate frequency with a corresponding primary fate increase. | Paper_evidence | WBPaper00038282 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000695 | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | ayIs4[lip-1p::gfp] | Paper_evidence | WBPaper00032102 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038282 | |||||||
WBPaper00032102 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |