WormBase Tree Display for Variation: WBVar00092100
expand all nodes | collapse all nodes | view schema
WBVar00092100 | Name | Public_name | ok821 | ||||
---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.4191019_4192163del | ||||||
Sequence_details | SMap | S_parent | Sequence | F20B6 | |||
Flanking_sequences | gagaaaaacagttacttatcgtatattttg | aagagacggatcaatcacacaaattccaat | |||||
Mapping_target | F20B6 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok821_external | ||||||
ok821_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031649 | ||||||
WBStrain00056634 | |||||||
Laboratory | RB | ||||||
DCD | |||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006921 | |||||
Transcript | F20B6.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-970 | ||||||
CDS_position | ?-968 | ||||||
Protein_position | ?-323 | ||||||
Intron_number | 2-3/5 | ||||||
Exon_number | 1-4/6 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0001507 | Paper_evidence | WBPaper00049138 | |||
Person_evidence | WBPerson18666 | ||||||
Curator_confirmed | WBPerson712 | ||||||
Remark | mutants are tolerant to Cry6Aa protein | Paper_evidence | WBPaper00049138 | ||||
Person_evidence | WBPerson18666 | ||||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00049138 | ||||||
WBPaper00065980 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |