WormBase Tree Display for Variation: WBVar00092131
expand all nodes | collapse all nodes | view schema
WBVar00092131 | Name | Public_name | ok856 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C05A9.1b.1:c.1984_2770del | |||||||
C05A9.1a.1:c.2260_3046del | ||||||||
CE43182:p.Lys662SerfsTer6 | ||||||||
CE43003:p.Lys754SerfsTer6 | ||||||||
HGVSg | CHROMOSOME_X:g.10855196_10856123del | |||||||
Sequence_details | SMap | S_parent | Sequence | C05A9 | ||||
Flanking_sequences | caccatccaaaatcattttgtctgagcgct | ttctgctgttttaccgaagaaataatattg | ||||||
Mapping_target | C05A9 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK856_external | |||||||
OK856_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031670 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003999 | ||||||
Transcript | C05A9.1b.1 (11) | |||||||
C05A9.1a.1 (11) | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000593 | Paper_evidence | WBPaper00031023 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | At concentrations of copper sulfate in which development of wild-type animals was impaired, the proportions of pgp-5(ok856) animals with developmental delay were significantly higher (Figure 2B). | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00031023 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001271 | Paper_evidence | WBPaper00031023 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | pgp-5(ok856) mutant animals exhibited reduced survival at 15 degrees Celsius in the presence of pathogenic Pseudomonas aeruginosa strain PA14 and Salmonella typhimurium strain SL1344, compared to wild type controls (Figure 2C, 2D). | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00031023 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001655 | Paper_evidence | WBPaper00031023 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | At concentrations of cadmium chloride in which development of wild-type animals was impaired, the proportions of pgp-5(ok856) animals with developmental delay were significantly higher (Figure 2A). | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00031023 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 2A, 2B | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00031023 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lifespan of the pgp-5(ok856) mutants was not different from that of N2 (wild type) animals at 25 degrees Celsius (data not shown) nor at 15 degrees Celsius (Figure S3C). | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000486 | Paper_evidence | WBPaper00031023 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | pgp-5(ok856) mutant animals responded normally to colchicine, compared to wild type controls (Figure S3A) | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003637 | Paper_evidence | WBPaper00031023 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002218 | Paper_evidence | WBPaper00031023 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | pgp-5(ok856) mutant animals responded normally to arsenite, compared to wild type controls (Figure S3A) | Paper_evidence | WBPaper00031023 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004596 | Paper_evidence | WBPaper00031023 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00027644 | |||||||
WBPaper00031023 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |