WormBase Tree Display for Variation: WBVar00092133
expand all nodes | collapse all nodes | view schema
| WBVar00092133 | Evidence | Paper_evidence | WBPaper00033444 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok858 | |||||
| Other_name | Y39A1C.3.1:c.665+234_*123del | ||||||
| HGVSg | CHROMOSOME_III:g.10867037_10867675del | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y39A1C | |||
| Flanking_sequences | actgagtggatataaatcgtgcagaacaaa | gtttttacaccaataggtaaccaaaaatgc | |||||
| Mapping_target | Y39A1C | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok858_external | ||||||
| ok858_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00031672 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000475 | |||||
| Transcript | Y39A1C.3.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y39A1C.3.1:c.665+234_*123del | ||||||
| cDNA_position | ?-1092 | ||||||
| Intron_number | 3/4 | ||||||
| Exon_number | 4-5/5 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Null | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00033444 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
