WormBase Tree Display for Variation: WBVar00092140
expand all nodes | collapse all nodes | view schema
WBVar00092140 | Name | Public_name | ok865 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.6535190_6537612del | |||||||
Sequence_details | SMap | S_parent | Sequence | C56E6 | ||||
Flanking_sequences | CAACTCCAATTCAACTTTATTCATGTGGAAGGACATTTTTGAATGTGAGT | GAAGCAATCAGTCTGATGCGTCTATTACAACCCTGCATTGTTTTGAAAAA | ||||||
Mapping_target | C56E6 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035882 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | Curator_confirmed | WBPerson4025 | |||||
Affects | Gene | WBGene00007050 | ||||||
WBGene00006522 | ||||||||
Transcript | F18C5.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-991 | |||||||
CDS_position | ?-981 | |||||||
Protein_position | ?-327 | |||||||
Intron_number | 2-6/27 | |||||||
Exon_number | 1-7/28 | |||||||
C56E6.1.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 11/11 | |||||||
Exon_number | 12/12 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 5584 | |||||
Description | Phenotype_not_observed | WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00027644 | |||||||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf268310 | |||||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | ||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |