WormBase Tree Display for Variation: WBVar00092155
expand all nodes | collapse all nodes | view schema
WBVar00092155 | Name | Public_name | ok880 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE39724:p.His598GlnfsTer15 | |||||||
F13E6.6.1:c.1794_2412del | ||||||||
HGVSg | CHROMOSOME_X:g.10700374_10701544del | |||||||
Sequence_details | SMap | S_parent | Sequence | F13E6 | ||||
Flanking_sequences | acaaaaacttaccttttcaacttctgctct | tgcgatctggataccaagccacgatccatg | ||||||
Mapping_target | F13E6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok880_external | |||||||
ok880_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031686 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006468 | ||||||
Transcript | F13E6.6.1 (11) | |||||||
Interactor | WBInteraction000052320 | |||||||
WBInteraction000534902 | ||||||||
WBInteraction000534903 | ||||||||
WBInteraction000534904 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | We found that the rhgf-1(ok880) and rhgf-1(gk217) mutants were defective in axon regeneration (Fig. 3d and Supplementary Table 2). | Paper_evidence | WBPaper00049131 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (9) | ||||||||
Reference | WBPaper00038487 | |||||||
WBPaper00040813 | ||||||||
WBPaper00028856 | ||||||||
WBPaper00045955 | ||||||||
WBPaper00049131 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |