WormBase Tree Display for Variation: WBVar00092159
expand all nodes | collapse all nodes | view schema
WBVar00092159 | Evidence | Paper_evidence | WBPaper00038481 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok884 | |||||||
Other_name | F32F2.1d.1:c.1011_2029-25del | ||||||||
F32F2.1a.2:c.912_1930-25del | |||||||||
F32F2.1c.1:c.1029_2047-25del | |||||||||
F32F2.1b.1:c.1071_2089-25del | |||||||||
F32F2.1a.3:c.912_1930-25del | |||||||||
F32F2.1a.1:c.912_1930-25del | |||||||||
F32F2.1e.1:c.480_1498-25del | |||||||||
HGVSg | CHROMOSOME_V:g.13275710_13277046del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F32F2 | |||||
Flanking_sequences | tgatatctatattagttaaaataaaatatt | tccacgaagcatctgctcatctgaaaataa | |||||||
Mapping_target | F32F2 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok884_external | ||||||||
ok884_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031688 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00235322 | |||||||
WBGene00009337 | |||||||||
Transcript | F32F2.4.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
F32F2.1h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 1-2/8 | ||||||||
Exon_number | 1-2/9 | ||||||||
F32F2.1a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1a.3:c.912_1930-25del | ||||||||
cDNA_position | 972-? | ||||||||
CDS_position | 912-? | ||||||||
Protein_position | 304-? | ||||||||
Intron_number | 7-9/16 | ||||||||
Exon_number | 7-9/17 | ||||||||
F32F2.1d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1d.1:c.1011_2029-25del | ||||||||
cDNA_position | 1011-? | ||||||||
CDS_position | 1011-? | ||||||||
Protein_position | 337-? | ||||||||
Intron_number | 7-9/15 | ||||||||
Exon_number | 7-9/16 | ||||||||
F32F2.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1a.1:c.912_1930-25del | ||||||||
cDNA_position | 1163-? | ||||||||
CDS_position | 912-? | ||||||||
Protein_position | 304-? | ||||||||
Intron_number | 8-10/17 | ||||||||
Exon_number | 8-10/18 | ||||||||
F32F2.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1b.1:c.1071_2089-25del | ||||||||
cDNA_position | 1071-? | ||||||||
CDS_position | 1071-? | ||||||||
Protein_position | 357-? | ||||||||
Intron_number | 7-9/15 | ||||||||
Exon_number | 7-9/16 | ||||||||
F32F2.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1c.1:c.1029_2047-25del | ||||||||
cDNA_position | 1029-? | ||||||||
CDS_position | 1029-? | ||||||||
Protein_position | 343-? | ||||||||
Intron_number | 7-9/15 | ||||||||
Exon_number | 7-9/16 | ||||||||
F32F2.1a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1a.2:c.912_1930-25del | ||||||||
cDNA_position | 1078-? | ||||||||
CDS_position | 912-? | ||||||||
Protein_position | 304-? | ||||||||
Intron_number | 8-10/17 | ||||||||
Exon_number | 8-10/18 | ||||||||
F32F2.1e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F32F2.1e.1:c.480_1498-25del | ||||||||
cDNA_position | 480-? | ||||||||
CDS_position | 480-? | ||||||||
Protein_position | 160-? | ||||||||
Intron_number | 3-5/11 | ||||||||
Exon_number | 3-5/12 | ||||||||
Interactor | WBInteraction000520143 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 5548 | ||||||
Description | Phenotype | WBPhenotype:0002587 | Paper_evidence | WBPaper00058750 | |||||
Curator_confirmed | WBPerson43910 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00038481 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | While PXL-1 is properly localized at dense bodies in uig-1 mutant animals. In uig-1 mutant worms, PXL-1 was properly localized to the pharyngeal muscle membrane (data not shown). | Paper_evidence | WBPaper00038481 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005451 | PATO:0000460 | Paper_evidence | WBPaper00038481 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038481 | ||||||||
WBPaper00058750 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |