WormBase Tree Display for Variation: WBVar00092166
expand all nodes | collapse all nodes | view schema
WBVar00092166 | Name | Public_name | ok892 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | K08F8.3.2:c.-15-167_545delinsTTCTTT | |||||||
HGVSg | CHROMOSOME_II:g.8757652_8758798delinsAAAGAA | |||||||
Sequence_details | SMap | S_parent | Sequence | K08F8 | ||||
Flanking_sequences | taatcaggccttggaatttgaattccagaa | taaagaatgaaaacaagtttcagactggta | ||||||
Mapping_target | K08F8 | |||||||
Type_of_mutation | Insertion | AAAGAA | ||||||
Deletion | ||||||||
PCR_product | ok892_external | |||||||
ok892_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035894 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001505 | ||||||
Transcript | K08F8.3.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | K08F8.3.2:c.-15-167_545delinsTTCTTT | |||||||
cDNA_position | ?-621 | |||||||
CDS_position | ?-545 | |||||||
Protein_position | ?-182 | |||||||
Intron_number | 1-6/12 | |||||||
Exon_number | 2-7/13 | |||||||
K08F8.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-560 | |||||||
CDS_position | ?-545 | |||||||
Protein_position | ?-182 | |||||||
Intron_number | 2-5/11 | |||||||
Exon_number | 1-6/12 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0002035 | Paper_evidence | WBPaper00041118 | ||||
Curator_confirmed | WBPerson9999 | |||||||
Remark | partial resistance to Coprinopsis cinerea fruiting body lectin CCL2 | Paper_evidence | WBPaper00041118 | |||||
Curator_confirmed | WBPerson9999 | |||||||
Affected_by | Molecule | WBMol:00007869 | Paper_evidence | WBPaper00041118 | ||||
Curator_confirmed | WBPerson9999 | |||||||
Reference | WBPaper00041118 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |