WormBase Tree Display for Variation: WBVar00092177
expand all nodes | collapse all nodes | view schema
WBVar00092177 | Name | Public_name | ok904 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE19271:p.Ala713TrpfsTer57 | ||||||||
Y76A2A.2b.1:c.2136_2557delinsTTGGAAA | |||||||||
CE26305:p.Ala835TrpfsTer57 | |||||||||
Y76A2A.2a.1:c.2502_2923delinsTTGGAAA | |||||||||
HGVSg | CHROMOSOME_III:g.13441327_13442936delinsTTTCCAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | |||||
Flanking_sequences | cacgtagagtatagattgcaagtgatgctt | accgcatttccaatcggatgctccgacaaa | |||||||
Mapping_target | CHROMOSOME_III | ||||||||
Type_of_mutation | Insertion | TTTCCAA | |||||||
Deletion | |||||||||
PCR_product | ok904_external | ||||||||
ok904_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003820 | ||||||||
WBStrain00035967 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000834 | |||||||
Transcript | Y76A2A.2b.1 (11) | ||||||||
Y76A2A.2a.1 (11) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00050460 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The strain VC672 contains a deletion in cua-1(ok904), spanning exons 13 through 15 (Fig. 2A; Supplemental Fig. S2C), which is genetically balanced due to the embryonic lethality of cua-1 mutant worms. Pcua-1::CUA-1.1::GFP, indicating that the CUA-1.1::GFP translational fusion protein is functional (Fig. 3C). | Paper_evidence | WBPaper00050460 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00023826 | ||||||||
WBTransgene00023827 | |||||||||
Affected_by | Molecule | WBMol:00002485 | Paper_evidence | WBPaper00050460 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004203 | Paper_evidence | WBPaper00050460 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000108 | PATO:0000297 | Paper_evidence | WBPaper00050460 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0055070 | PATO:0000460 | Paper_evidence | WBPaper00050460 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Molecule_affected | WBMol:00007840 | PATO:0000460 | Paper_evidence | WBPaper00050460 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00035967 | Paper_evidence | WBPaper00050460 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:1838 | |||||||
Models_disease_in_annotation | WBDOannot00000385 | ||||||||
Reference | WBPaper00050460 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |