WormBase Tree Display for Variation: WBVar00092206
expand all nodes | collapse all nodes | view schema
WBVar00092206 | Name | Public_name | ok935 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | K06B9.5a.1:c.250+689_551del | ||||||||
K06B9.5b.1:c.64+126_365del | |||||||||
HGVSg | CHROMOSOME_IV:g.4201596_4203215del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K06B9 | |||||
Flanking_sequences | atcaatttctgtcgtatttcccatgcgaac | cgcaaaatattgttggactggcaaaaagag | |||||||
Mapping_target | K06B9 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok935_external | ||||||||
ok935_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031722 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003938 | |||||||
Transcript | K06B9.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K06B9.5b.1:c.64+126_365del | ||||||||
cDNA_position | ?-365 | ||||||||
CDS_position | ?-365 | ||||||||
Protein_position | ?-122 | ||||||||
Intron_number | 1-3/6 | ||||||||
Exon_number | 2-4/7 | ||||||||
K06B9.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K06B9.5a.1:c.250+689_551del | ||||||||
cDNA_position | ?-551 | ||||||||
CDS_position | ?-551 | ||||||||
Protein_position | ?-184 | ||||||||
Intron_number | 2-4/8 | ||||||||
Exon_number | 3-5/9 | ||||||||
Interactor (12) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000183 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005738 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00028561 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had decreased numbers of unc-4::gfp expressing VC motorneurons compared to wild type. | Paper_evidence | WBPaper00028561 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | unc-4::gfp | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00028561 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Germline corpses were quantified in staged adults (generally 24 hours after L4/adult molt) stained with SYTO12. | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | ced-10(RNAi) | Paper_evidence | WBPaper00028561 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001181 | Paper_evidence | WBPaper00028561 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005738 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Cell corpses were observed by Nomarski optics. | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00023860 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00023860 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00023860 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00023860 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00028561 | ||||||||
WBPaper00023860 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |