WormBase Tree Display for Variation: WBVar00092226
expand all nodes | collapse all nodes | view schema
WBVar00092226 | Name | Public_name | ok955 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | E03G2.2.1:c.1853_2160+274del | |||||||
HGVSg | CHROMOSOME_X:g.15934519_15935176del | |||||||
Sequence_details | SMap | S_parent | Sequence | E03G2 | ||||
Flanking_sequences | gaacaacttactaagccagctcttcggaat | caatagctgcagtgtcaacttccttctcac | ||||||
Mapping_target | E03G2 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok955_external | |||||||
ok955_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031736 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003409 | ||||||
Transcript | E03G2.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | E03G2.2.1:c.1853_2160+274del | |||||||
cDNA_position | 1855-? | |||||||
CDS_position | 1853-? | |||||||
Protein_position | 618-? | |||||||
Intron_number | 11-12/24 | |||||||
Exon_number | 11-12/25 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype_not_observed | WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00027644 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |