WormBase Tree Display for Variation: WBVar00092247

WBVar00092247 Evidence: Paper_evidence: WBPaper00032243
  Name: Public_name: ok976
    Other_name: C09G4.1a.1:c.417-351_721del
      C09G4.1b.1:c.429-351_733del
      C09G4.1c.1:c.408-351_712del
    HGVSg: CHROMOSOME_IV:g.8542471_8543333del
  Sequence_details: SMap: S_parent: Sequence: C09G4
    Flanking_sequences: gagtttagcaattgtattatttaattcttc cattcattgttattcgctcagcagttacag
    Mapping_target: C09G4
    Type_of_mutation: Deletion
    PCR_product: ok976_external
      ok976_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031744
      WBStrain00040672
      WBStrain00040673
      WBStrain00040674
      WBStrain00040676
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00002043
    Transcript: C09G4.1c.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C09G4.1c.1:c.408-351_712del
        cDNA_position: ?-712
        CDS_position: ?-712
        Protein_position: ?-238
        Intron_number: 3-4/7
        Exon_number: 4-5/8
      C09G4.1b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C09G4.1b.1:c.429-351_733del
        cDNA_position: ?-733
        CDS_position: ?-733
        Protein_position: ?-245
        Intron_number: 4-5/7
        Exon_number: 5-6/8
      C09G4.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C09G4.1a.1:c.417-351_721del
        cDNA_position: ?-721
        CDS_position: ?-721
        Protein_position: ?-241
        Intron_number: 4-5/8
        Exon_number: 5-6/9
    Interactor (18)
  Isolation: Mutagen: UV/TMP
  Description: Phenotype: WBPhenotype:0000138 Paper_evidence: WBPaper00043981
        Curator_confirmed: WBPerson2987
        Remark: hyl-1(ok976) mutants exhibit drastically reduced levels of sphingomyelin (SM) species containing C16-18 and C26 fatty acid residues (e.g. SM33:1;2, SM35:1;2 and 43:1;3) (Figure S8C-D, J) Paper_evidence: WBPaper00043981
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000717 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: 120-Gy-induced p53-mediated egl-1 (left) and ced-13 (right) up-regulation were not affected, as measured by reverse transcription polymerase chain reaction. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
      WBPhenotype:0001172 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Age-related and radiation-induced germ cell apoptosis were nearly abolished compared to wild-type animals. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: L3-L4 larvae were assayed. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
      WBPhenotype:0002541 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Radiation-induced germ cell apoptosis was inhibited. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: At least 20 animals were scored for germ cell apoptosis at 36 hours post-120 Gy and compared to WT-irradiated controls. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00043981
        Curator_confirmed: WBPerson2987
        Remark: hyl-1(ok976) mutant animals display no change in lifespan compared to (wild type) N2 (P =0.3592). (Figure S2A,F) Paper_evidence: WBPaper00043981
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: All lifespan analyses were conducted at 20 degrees Celsius on worms nonstarved for at least two generations. For the OP50 lifespan assays (Figure S2), synchronized L4 worms were transferred to plates containing 100 micromolar FUDR (5-fluoro-2'-deoxyuridine, 50503 Sigma) to prevent progeny from developing and counted every 1-2 days. Lifespan is defined as the time from when the worms were placed on FUDR plates to the time when they were scored as dead. Statistical analyses were performed by Gehan-Breslow-Wilcoxon tests. The Bonferroni method was used to correct for multiple comparisons and P-values equivalent to a significance level of 0.05 were considered statistically significant. Worms that "exploded", were bagged, or went missing were censored the day the event was observed. Paper_evidence: WBPaper00043981
              Curator_confirmed: WBPerson2987
          Temperature: 20 Paper_evidence: WBPaper00043981
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000648 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Mating efficiency was not significantly different from wild type. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For each strain, 16 males were mated with 16 late L4 stage unc-51 hermaphrodites for 24 hours and then scored for cross progeny (non-Dpy progeny) and self progeny. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Brood size was not significantly different from wild type. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
      WBPhenotype:0000812 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: The number of germ cell nuclei, 327.5 15.9 (n=10), was slightly less than wild type, 366.6 14.6 (n=10), based on the number of DAPI stained nuclei in one side of the distal gonad. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
      WBPhenotype:0000885 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: The rate of germ cell corpse removal was unaffected. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: L3-L4 larvae were assayed. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
      WBPhenotype:0000965 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: 0.17 0.38 (30) extra cells were counted in the anterior pharynx, similar to wild-type animals 0.05 0.22 (n=20). Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: L3-L4 larvae were assayed. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
  Reference: WBPaper00032243
    WBPaper00043981
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele