WormBase Tree Display for Variation: WBVar00092250
expand all nodes | collapse all nodes | view schema
WBVar00092250 | Evidence | Paper_evidence | WBPaper00032221 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok979 | |||||||
Other_name | C51E3.7a.1:c.418-139_1349del | ||||||||
C51E3.7c.1:c.43-139_974del | |||||||||
HGVSg | CHROMOSOME_V:g.10170675_10172252del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C51E3 | |||||
Flanking_sequences | ttcatttgccattcaaagtgagaacagttt | gaaagcaacggaaagacgagacgaaaggaa | |||||||
Mapping_target | C51E3 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok979_external | ||||||||
ok979_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035966 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001172 | |||||||
Transcript | C51E3.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C51E3.7a.1:c.418-139_1349del | ||||||||
cDNA_position | ?-1351 | ||||||||
CDS_position | ?-1349 | ||||||||
Protein_position | ?-450 | ||||||||
Intron_number | 3-6/9 | ||||||||
Exon_number | 4-7/10 | ||||||||
C51E3.7c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C51E3.7c.1:c.43-139_974del | ||||||||
cDNA_position | ?-974 | ||||||||
CDS_position | ?-974 | ||||||||
Protein_position | ?-325 | ||||||||
Intron_number | 1-4/6 | ||||||||
Exon_number | 2-5/7 | ||||||||
Interactor | WBInteraction000009144 | ||||||||
WBInteraction000518053 | |||||||||
WBInteraction000518554 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype_not_observed | WBPhenotype:0001818 | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSNs showed robust and rhythmic activity. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00032221 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:1574 | |||||||
Models_disease_in_annotation | WBDOannot00000710 | ||||||||
Reference | WBPaper00032221 | ||||||||
WBPaper00036237 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |