WormBase Tree Display for Variation: WBVar00092270
expand all nodes | collapse all nodes | view schema
WBVar00092270 | Evidence | Paper_evidence | WBPaper00038142 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok999 | |||||
Other_name | C29E6.2a.1:c.494+131_1398del | ||||||
C29E6.2b.1:c.491+131_1395del | |||||||
HGVSg | CHROMOSOME_IV:g.11865611_11866944del | ||||||
Sequence_details | SMap | S_parent | Sequence | C29E6 | |||
Flanking_sequences | atttaaaatttttaaatacaaatatcaatg | gtcaatatggtagatcgagatcaaaacact | |||||
Mapping_target | C29E6 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok999_external | ||||||
ok999_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031758 | ||||||
WBStrain00034933 | |||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00007801 | |||||
Transcript | C29E6.2a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C29E6.2a.1:c.494+131_1398del | ||||||
cDNA_position | ?-1413 | ||||||
CDS_position | ?-1398 | ||||||
Protein_position | ?-466 | ||||||
Intron_number | 3/12 | ||||||
Exon_number | 4/13 | ||||||
C29E6.2b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C29E6.2b.1:c.491+131_1395del | ||||||
cDNA_position | ?-1416 | ||||||
CDS_position | ?-1395 | ||||||
Protein_position | ?-465 | ||||||
Intron_number | 3/12 | ||||||
Exon_number | 4/13 | ||||||
Interactor | WBInteraction000519486 | ||||||
WBInteraction000519492 | |||||||
WBInteraction000519493 | |||||||
WBInteraction000519500 | |||||||
WBInteraction000519501 | |||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 5308 | ||||
Description | Phenotype (14) | ||||||
Phenotype_not_observed | WBPhenotype:0001273 | Paper_evidence | WBPaper00038142 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Using a thermal barrier assay to test heat avoidance, no defect in heat avoidance was observed. | Paper_evidence | WBPaper00038142 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038142 | ||||||
WBPaper00043908 | |||||||
WBPaper00065340 | |||||||
WBPaper00065312 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |