WormBase Tree Display for Variation: WBVar00092334
expand all nodes | collapse all nodes | view schema
WBVar00092334 | Name | Public_name | ok1065 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y48A6A.1.1:c.328+44_439+56delinsCCCCAA | ||||||||
HGVSg | CHROMOSOME_III:g.10952218_10953037delinsTTGGGG | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y48A6A | |||||
Flanking_sequences | cgatattttaaaataaaaattgattgctca | atcagtaatggcctatcattccaaaaccac | |||||||
Mapping_target | Y48A6A | ||||||||
Type_of_mutation | Insertion | TTGGGG | |||||||
Deletion | |||||||||
PCR_product | ok1065_external | ||||||||
ok1065_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036013 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006982 | |||||||
Transcript | Y48A6A.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y48A6A.1.1:c.328+44_439+56delinsCCCCAA | ||||||||
Intron_number | 3-4/6 | ||||||||
Exon_number | 4/7 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4943 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00035166 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000072 | Paper_evidence | WBPaper00035166 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any gross morphological defects compared to control animals. | Paper_evidence | WBPaper00035166 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00035166 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001503 | Paper_evidence | WBPaper00035166 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Neuroanatomical analysis of the ventral nerve cord architecture, including the placement of neuron soma, demonstrated no significant post-developmental differences from control animals. | Paper_evidence | WBPaper00035166 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005300 | PATO:0000460 | Paper_evidence | WBPaper00035166 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032446 | ||||||||
WBPaper00035166 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |