WormBase Tree Display for Variation: WBVar00092371
expand all nodes | collapse all nodes | view schema
WBVar00092371 | Evidence | Paper_evidence | WBPaper00031296 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1102 | ||||||
Other_name | CE31384:p.Ala195SerfsTer92 | |||||||
CE31385:p.Ala195SerfsTer92 | ||||||||
Y65B4BR.4b.1:c.579_753del | ||||||||
Y65B4BR.4a.1:c.579_753del | ||||||||
HGVSg | CHROMOSOME_I:g.537820_538860del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y65B4BR | ||||
Flanking_sequences | gcggagaccggcgacagcgaagcgtgacac | actcagccattgccacagggatgggaaatg | ||||||
Mapping_target | Y65B4BR | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1102_external | |||||||
OK1102_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031879 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007009 | ||||||
Transcript | Y65B4BR.4a.1 (11) | |||||||
Y65B4BR.4b.1 (11) | ||||||||
Interactor | WBInteraction000052312 | |||||||
WBInteraction000503410 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 5001 | |||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00031296 | ||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 60% | Paper_evidence | WBPaper00031296 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000275 | Paper_evidence | WBPaper00031296 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are not hypersensitive to UV irradiation. % adult survival 0-96 hours after UV irradiation is similar to wild type animals. | Paper_evidence | WBPaper00031296 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals treated with 100 J/m2 UV irradiation. Data was reported as an average of three independent experiments with at least 90 animals each. | Paper_evidence | WBPaper00031296 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031296 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |