WormBase Tree Display for Variation: WBVar00092433
expand all nodes | collapse all nodes | view schema
WBVar00092433 | Name | Public_name | ok1177 | ||||
---|---|---|---|---|---|---|---|
Other_name | M04C9.5a.1:c.223-39_1193-120del | ||||||
M04C9.5b.1:c.223-39_1193-120del | |||||||
HGVSg | CHROMOSOME_I:g.9360865_9362583del | ||||||
Sequence_details | SMap | S_parent | Sequence | M04C9 | |||
Flanking_sequences | atggacaattggatgcattttctgtagttg | gacttgctcataccttatttgaattgtgat | |||||
Mapping_target | M04C9 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK1177_external | ||||||
OK1177_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031850 | ||||||
WBStrain00056606 | |||||||
WBStrain00056607 | |||||||
Laboratory | RB | ||||||
CZ | |||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00050921 | |||||
WBGene00001121 | |||||||
Transcript | M04C9.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | M04C9.5b.1:c.223-39_1193-120del | ||||||
Intron_number | 4-9/12 | ||||||
Exon_number | 5-9/13 | ||||||
M04C9.8 | |||||||
M04C9.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | M04C9.5a.1:c.223-39_1193-120del | ||||||
Intron_number | 4-9/9 | ||||||
Exon_number | 5-9/10 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0000615 | Paper_evidence | WBPaper00029264 | |||
Curator_confirmed | WBPerson291 | ||||||
Remark | Amphid and phasmid cilia are longer, more dispersed, misdirected and sometimes turn back towards the transition zone | Paper_evidence | WBPaper00029264 | ||||
Curator_confirmed | WBPerson291 | ||||||
Reference | WBPaper00029264 | ||||||
WBPaper00065994 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |