WormBase Tree Display for Variation: WBVar00092465
expand all nodes | collapse all nodes | view schema
| WBVar00092465 | Name | Public_name | ok1211 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | M110.4b.1:c.859_2636del | ||||||
| M110.4e.1:c.871_2651del | |||||||
| M110.4d.1:c.871_2648del | |||||||
| M110.4a.1:c.859_2639del | |||||||
| CE35745:p.Ala287IlefsTer7 | |||||||
| CE02277:p.Ala287IlefsTer7 | |||||||
| CE53003:p.Ala291IlefsTer7 | |||||||
| M110.4c.1:c.517_2297del | |||||||
| CE42917:p.Ala173IlefsTer7 | |||||||
| CE53041:p.Ala291IlefsTer7 | |||||||
| HGVSg | CHROMOSOME_II:g.8218355_8220293del | ||||||
| Sequence_details | SMap | S_parent | Sequence | M110 | |||
| Flanking_sequences | catgcatcagacacaaccaccactacgccc | atcagcttgggggcgacgtgattccaatga | |||||
| Mapping_target | M110 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok1211_external | ||||||
| ok1211_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00024079 | ||||||
| WBStrain00036060 | |||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002066 | |||||
| Transcript | M110.4c.1 (11) | ||||||
| M110.4e.1 (11) | |||||||
| M110.4b.1 (11) | |||||||
| M110.4d.1 (11) | |||||||
| M110.4a.1 (11) | |||||||
| Isolation | Mutagen | UV/TMP | |||||
| Genetics | Mapping_data | In_multi_point | 5120 | ||||
| Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00031847 | |||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "Worms lacking functional ifg-1 gene developed to the larval L1/L2 transition (12 h normal development) and then ceased further growth or development (Figure 6b)... In contrast to ifg-1(RNAi) phenotypes, the somatic growth arrest of ifg-1(-/-) worms was matched by arrest of germline proliferation (insets). The gonad of ifg-1(-/-) worms contained only 6-10 mitotic germ cells, indicating that the primordial germ cells (Z2 and Z3) divided just a few times before arresting (Figure 6c)." | Paper_evidence | WBPaper00031847 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Recessive | Paper_evidence | WBPaper00031847 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00031847 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00031847 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
