WormBase Tree Display for Variation: WBVar00092473
expand all nodes | collapse all nodes | view schema
WBVar00092473 | Evidence | Paper_evidence | WBPaper00038354 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1221 | ||||||
HGVSg | CHROMOSOME_II:g.4324028_4325074del | |||||||
Sequence_details | SMap | S_parent | Sequence | H20J04 | ||||
Flanking_sequences | gaaacagcatttatttcagccgaaacagtt | cgaaaaattttaagccatttttcgaaaaat | ||||||
Mapping_target | H20J04 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok1221_external | |||||||
ok1221_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00036069 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019221 | ||||||
WBGene00003390 | ||||||||
Transcript | H20J04.6.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 623-? | |||||||
Exon_number | 6/6 | |||||||
H20J04.8.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 1-2/4 | |||||||
Interactor | WBInteraction000501293 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 5349 | |||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00038354 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mog-2 alleles grew significantly slower than wild type siblings at 15 deg C and 20 deg C. Furthermore, mog-2(q75) larvae required more time to develop into adults than mog-2(ok1221). | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20, 25 | Paper_evidence | WBPaper00038354 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | At 25 deg C, 100% of the progeny of homozygous mog-2 mutants died as embryos, without showing signs of morphogenesis. | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20, 25 | Paper_evidence | WBPaper00038354 | ||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000683 | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Hermaphrodites developed as somatic females that made excess of sperm and no oocytes. At 25 deg C, most germ lines are fully masculinized. | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20, 25 | Paper_evidence | WBPaper00038354 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001369 | Paper_evidence | WBPaper00038354 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | U2 snRNA was not coimmunoprecipitated in the absence of MOG-2 in a mog-2(ok1221) null mutant. | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000508 | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | While an alternatively spliced variant of the rpl-7A was detected in smg-1 and smg-1; mog-2 mutants, it was observed neither in wild type, nor in mog-2 animals. | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038354 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038354 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |