WormBase Tree Display for Variation: WBVar00092501
expand all nodes | collapse all nodes | view schema
WBVar00092501 | Evidence | Person_evidence | WBPerson14863 | ||
---|---|---|---|---|---|
Name | Public_name | ok1255 | |||
Other_name | CE46969:p.Ile71LysfsTer27 | ||||
Y47D3A.16.1:c.212_1016del | |||||
HGVSg | CHROMOSOME_III:g.11246933_11248745del | ||||
Sequence_details | SMap | S_parent | Sequence | Y47D3A | |
Flanking_sequences | tggaatcgattcaactgtgtgccagtgcaa | aagtcatgcgtttttcaagactacggactg | |||
Mapping_target | Y47D3A | ||||
Type_of_mutation | Deletion | ||||
PCR_product | OK1255_external | ||||
OK1255_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00031907 | ||||
WBStrain00057383 | |||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00012929 | |||
Transcript | Y47D3A.16.1 (11) | ||||
Interactor | WBInteraction000008531 | ||||
WBInteraction000008533 | |||||
WBInteraction000008534 | |||||
WBInteraction000500251 | |||||
WBInteraction000520358 | |||||
WBInteraction000521005 | |||||
WBInteraction000573292 | |||||
Genetics | Interpolated_map_position | III | 8.08606 | ||
Mapping_data | In_multi_point | 5138 | |||
Description (2) | |||||
Reference | WBPaper00039835 | ||||
WBPaper00029007 | |||||
WBPaper00036348 | |||||
WBPaper00065803 | |||||
Remark | ok1255 is a 1700bp deletion | Paper_evidence | WBPaper00050108 | ||
Sequenced ok1255 mutation in VB1479 to determine exact coordinates of deletion. | Person_evidence | WBPerson14863 | |||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson14863 on 2023-11-9_12:08:47 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Method | Deletion_allele |