WormBase Tree Display for Variation: WBVar00092501
expand all nodes | collapse all nodes | view schema
WBVar00092501 | Evidence | Person_evidence | WBPerson14863 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1255 | ||||||
Other_name | CE46969:p.Ile71LysfsTer27 | |||||||
Y47D3A.16.1:c.212_1016del | ||||||||
HGVSg | CHROMOSOME_III:g.11246933_11248745del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3A | ||||
Flanking_sequences | tggaatcgattcaactgtgtgccagtgcaa | aagtcatgcgtttttcaagactacggactg | ||||||
Mapping_target | Y47D3A | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1255_external | |||||||
OK1255_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031907 | |||||||
WBStrain00057383 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00012929 | ||||||
Transcript | Y47D3A.16.1 (11) | |||||||
Interactor (7) | ||||||||
Genetics | Interpolated_map_position | III | 8.08606 | |||||
Mapping_data | In_multi_point | 5138 | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00029007 | ||||
WBPaper00036348 | ||||||||
WBPaper00039835 | ||||||||
Curator_confirmed | WBPerson557 | |||||||
WBPerson2021 | ||||||||
Remark | rsks-1 mutation produced a moderate increase in lifespan compared to wild-type | Paper_evidence | WBPaper00036348 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000121 | Paper_evidence | WBPaper00029007 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Reduced rate of protein translation. | Paper_evidence | WBPaper00029007 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000473 | Paper_evidence | WBPaper00036348 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Qualitatively, these animals appeared uncoordinated as they aged both when examined on plates or in liquid. | Paper_evidence | WBPaper00036348 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000674 | Paper_evidence | WBPaper00029007 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Rate of development decreased. | Paper_evidence | WBPaper00029007 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Quantified developmental timing using body length over time. | Paper_evidence | WBPaper00029007 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001384 | Paper_evidence | WBPaper00029007 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00036348 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The swim cycles changed in form and were interrupted frequently by uncoordinated movements, for example twisting movements out of the plane of swimming and kinking or curling. | Paper_evidence | WBPaper00036348 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001739 | Paper_evidence | WBPaper00036348 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants showed a reduction in age-related decline as demonstrated by vigorous swimming late in life. Older day 16 rsks-1(ok1255) animals showed significantly less increase in swim cycle duration than wild-type | Paper_evidence | WBPaper00036348 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0001273 | Paper_evidence | WBPaper00029007 | |||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Measured thermotolerance. | Paper_evidence | WBPaper00029007 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | thermotolerance measured as survival time at 35 C | Paper_evidence | WBPaper00029007 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00039835 | |||||||
WBPaper00029007 | ||||||||
WBPaper00036348 | ||||||||
WBPaper00065803 | ||||||||
Remark | ok1255 is a 1700bp deletion | Paper_evidence | WBPaper00050108 | |||||
Sequenced ok1255 mutation in VB1479 to determine exact coordinates of deletion. | Person_evidence | WBPerson14863 | ||||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson14863 on 2023-11-9_12:08:47 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
Method | Deletion_allele |