WormBase Tree Display for Variation: WBVar00092549
expand all nodes | collapse all nodes | view schema
WBVar00092549 | Evidence | Person_evidence | WBPerson7734 | ||
---|---|---|---|---|---|
Name | Public_name | ok1316 | |||
Other_name | CE30414:p.His436_Ter692delinsGln | ||||
C01F4.2a.1:c.1308_2075del | |||||
HGVSg | CHROMOSOME_I:g.4852402_4853264del | ||||
Sequence_details | SMap | S_parent | Sequence | C01F4 | |
Flanking_sequences | aacaaaatcggagccagaaatgatgagtca | acttcatgagacgctcgccgagaatgagca | |||
Mapping_target | C01F4 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | OK1316_external | ||||
OK1316_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00031952 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
WBPerson7734 | |||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00015303 | |||
Transcript | C01F4.2b.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
cDNA_position | 1308-? | ||||
CDS_position | 1308-? | ||||
Protein_position | 436-? | ||||
Exon_number | 9/9 | ||||
C01F4.2a.1 (11) | |||||
Remark | Allele sequenced by Elizabeth Marsh | Curator_confirmed | WBPerson2970 | ||
Flanking sequences may be gctcattctcggcgagcgtctcatgaagtt & gactcatcatttctggctccgattttgttg rather than those described above. | Person_evidence | WBPerson7734 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |