WormBase Tree Display for Variation: WBVar00092557
expand all nodes | collapse all nodes | view schema
| WBVar00092557 | Evidence | Paper_evidence | WBPaper00031961 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok1328 | |||||
| Other_name | C01G5.2:n.1015_2292del | ||||||
| HGVSg | CHROMOSOME_IV:g.6527241_6528697del | ||||||
| Sequence_details | SMap | S_parent | Sequence | C01G5 | |||
| Flanking_sequences | ttgtaggacacgggtgttacagttccctgg | atataattgacctgtggaggctctcctggt | |||||
| Mapping_target | C01G5 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok1328_external | ||||||
| ok1328_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00036079 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004179 | |||||
| WBGene00305249 | |||||||
| Transcript | C01G5.26 | ||||||
| Pseudogene | C01G5.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,non_coding_transcript_exon_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C01G5.2:n.1015_2292del | ||||||
| cDNA_position | 1015-2292 | ||||||
| Intron_number | 3-6/7 | ||||||
| Exon_number | 3-7/8 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Genetics | Mapping_data | In_multi_point | 5204 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0001759 | Paper_evidence | WBPaper00031961 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | 21U-RNA expression was not altered compared with expression in wild-type animals. | Paper_evidence | WBPaper00031961 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001779 | Paper_evidence | WBPaper00031961 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | miRNA expression was not altered. | Paper_evidence | WBPaper00031961 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00031961 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
